American Journal of Engineering & Natural Sciences (AJENS) ISSN 2074-112X

Original Research Contributions in Genetic Biongineering And Natural Genome Editing


Adamts12 Gener

Lab Reagents

Adamts13 Assay Laboratories manufactures the adamts12 gener reagents distributed by Genprice. The Adamts12 Gener reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact adamts13 assay. Other Adamts12 products are available in stock. Specificity: Adamts12 Category: Gener

Serum / Plasma information

ADAMTS12 Blocking Peptide

DF9170-BP 1mg
EUR 195

ADAMTS12 cloning plasmid

CSB-CL001300HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 690
  • Sequence: atgccatgtgcccagaggagctggcttgcaaacctttccgtggtggctcagctccttaactttggggcgctttgctatgggagacagcctcagccaggcccggttcgcttcccggacaggaggcaagagcattttatcaagggcctgccagaataccacgtggtgggtccagtccg
  • Show more
Description: A cloning plasmid for the ADAMTS12 gene.

ADAMTS12 cloning plasmid

CSB-CL001300HU2-10ug 10ug
EUR 1769
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4530
  • Show more
Description: A cloning plasmid for the ADAMTS12 gene.

ADAMTS12 cloning plasmid

CSB-CL001300HU3-10ug 10ug
EUR 303
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 690
  • Show more
Description: A cloning plasmid for the ADAMTS12 gene.

Anti-ADAMTS12 antibody

PAab00146 100 ug
EUR 386

Human ADAMTS12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-25225h 96 Tests
EUR 824


EF006571 96 Tests
EUR 689

Mouse Adamts12 ELISA KIT

ELI-34415m 96 Tests
EUR 865

Mouse ADAMTS12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADAMTS12 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS12. Recognizes ADAMTS12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADAMTS12 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS12. Recognizes ADAMTS12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADAMTS12 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS12. Recognizes ADAMTS12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ADAMTS12 Polyclonal Antibody, HRP Conjugated

A62055 100 µg
EUR 570.55
Description: fast delivery possible

ADAMTS12 Polyclonal Antibody, FITC Conjugated

A62056 100 µg
EUR 570.55
Description: reagents widely cited

ADAMTS12 Polyclonal Antibody, Biotin Conjugated

A62057 100 µg
EUR 570.55
Description: Ask the seller for details

ADAMTS12 ORF Vector (Human) (pORF)

ORF000178 1.0 ug DNA
EUR 95

Recent Posts

April 2021

