Lab Reagents
Adamts13 Assay Laboratories manufactures the adamts12 gener reagents distributed by Genprice. The Adamts12 Gener reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact adamts13 assay. Other Adamts12 products are available in stock. Specificity: Adamts12 Category: Gener
Serum / Plasma information
ADAMTS12 Blocking Peptide |
DF9170-BP |
Affbiotech |
1mg |
EUR 195 |
ADAMTS12 cloning plasmid |
CSB-CL001300HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 690
- Sequence: atgccatgtgcccagaggagctggcttgcaaacctttccgtggtggctcagctccttaactttggggcgctttgctatgggagacagcctcagccaggcccggttcgcttcccggacaggaggcaagagcattttatcaagggcctgccagaataccacgtggtgggtccagtccg
- Show more
|
Description: A cloning plasmid for the ADAMTS12 gene. |
ADAMTS12 cloning plasmid |
CSB-CL001300HU2-10ug |
Cusabio |
10ug |
EUR 1769 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4530
- Sequence: ATGCCATGTGCCCAGAGGAGCTGGCTTGCAAACCTTTCCGTGGTGGCTCAGCTCCTTAACTTTGGGGCGCTTTGCTATGGGAGACAGCCTCAGCCAGGCCCGGTTCGCTTCCCGGACAGGAGGCAAGAGCATTTTATCAAGGGCCTGCCAGAATACCACGTGGTGGGTCCAGTCC
- Show more
|
Description: A cloning plasmid for the ADAMTS12 gene. |
ADAMTS12 cloning plasmid |
CSB-CL001300HU3-10ug |
Cusabio |
10ug |
EUR 303 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 690
- Sequence: ATGCCATGTGCCCAGAGGAGCTGGCTTGCAAACCTTTCCGTGGTGGCTCAGCTCCTTAACTTTGGGGCGCTTTGCTATGGGAGACAGCCTCAGCCAGGCCCGGTTCGCTTCCCGGACAGGAGGCAAGAGCATTTTATCAAGGGCCTGCCAGAATACCACGTGGTGGGTCCAGTCCG
- Show more
|
Description: A cloning plasmid for the ADAMTS12 gene. |
Human ADAMTS12 shRNA Plasmid |
20-abx963050 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ADAMTS12 shRNA Plasmid |
20-abx982382 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ADAMTS12 Antibody, HRP conjugated |
1-CSB-PA001300LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ADAMTS12. Recognizes ADAMTS12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ADAMTS12 Antibody, FITC conjugated |
1-CSB-PA001300LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ADAMTS12. Recognizes ADAMTS12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ADAMTS12 Antibody, Biotin conjugated |
1-CSB-PA001300LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ADAMTS12. Recognizes ADAMTS12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ADAMTS12 Polyclonal Antibody, HRP Conjugated |
A62055 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
ADAMTS12 Polyclonal Antibody, FITC Conjugated |
A62056 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
ADAMTS12 Polyclonal Antibody, Biotin Conjugated |
A62057 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
ADAMTS12 ORF Vector (Human) (pORF) |
ORF000178 |
ABM |
1.0 ug DNA |
EUR 95 |