American Journal of Engineering & Natural Sciences (AJENS) ISSN 2074-112X

Original Research Contributions in Genetic Biongineering And Natural Genome Editing

fallback-image

Adamts12 Gener

Lab Reagents

Adamts13 Assay Laboratories manufactures the adamts12 gener reagents distributed by Genprice. The Adamts12 Gener reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact adamts13 assay. Other Adamts12 products are available in stock. Specificity: Adamts12 Category: Gener

Serum / Plasma information

ADAMTS12 cloning plasmid

CSB-CL001300HU2-10ug 10ug
EUR 1769
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4530
  • Sequence: ATGCCATGTGCCCAGAGGAGCTGGCTTGCAAACCTTTCCGTGGTGGCTCAGCTCCTTAACTTTGGGGCGCTTTGCTATGGGAGACAGCCTCAGCCAGGCCCGGTTCGCTTCCCGGACAGGAGGCAAGAGCATTTTATCAAGGGCCTGCCAGAATACCACGTGGTGGGTCCAGTCC
  • Show more
Description: A cloning plasmid for the ADAMTS12 gene.

ADAMTS12 cloning plasmid

CSB-CL001300HU3-10ug 10ug
EUR 303
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 690
  • Sequence: ATGCCATGTGCCCAGAGGAGCTGGCTTGCAAACCTTTCCGTGGTGGCTCAGCTCCTTAACTTTGGGGCGCTTTGCTATGGGAGACAGCCTCAGCCAGGCCCGGTTCGCTTCCCGGACAGGAGGCAAGAGCATTTTATCAAGGGCCTGCCAGAATACCACGTGGTGGGTCCAGTCCG
  • Show more
Description: A cloning plasmid for the ADAMTS12 gene.

ADAMTS12 Polyclonal Antibody

A62054 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- ADAMTS12 antibody

FNab00146 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: ADAM metallopeptidase with thrombospondin type 1 motif, 12
  • Uniprot ID: P58397
  • Gene ID: 81792
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ADAMTS12

Anti-ADAMTS12 antibody

PAab00146 100 ug
EUR 386

ADAMTS12 Antibody, HRP conjugated

1-CSB-PA001300LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS12. Recognizes ADAMTS12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADAMTS12 Antibody, FITC conjugated

1-CSB-PA001300LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS12. Recognizes ADAMTS12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADAMTS12 Antibody, Biotin conjugated

1-CSB-PA001300LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS12. Recognizes ADAMTS12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human ADAMTS12 ELISA KIT

ELI-25225h 96 Tests
EUR 824

ADAMTS12 ELISA KIT|Human

EF006571 96 Tests
EUR 689

Mouse ADAMTS12 shRNA Plasmid

20-abx982382
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ADAMTS12 shRNA Plasmid

20-abx963050
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Adamts12 ELISA KIT

ELI-34415m 96 Tests
EUR 865

ADAMTS12 Polyclonal Antibody, HRP Conjugated

A62055 100 µg
EUR 570.55
Description: fast delivery possible

ADAMTS12 Polyclonal Antibody, FITC Conjugated

A62056 100 µg
EUR 570.55
Description: reagents widely cited

ADAMTS12 Polyclonal Antibody, Biotin Conjugated

A62057 100 µg
EUR 570.55
Description: Ask the seller for details

Adamts12 ORF Vector (Rat) (pORF)

ORF063063 1.0 ug DNA
EUR 2080

Recent Posts

October 2021
M T W T F S S
 123
45678910
11121314151617
18192021222324
25262728293031

Tags

Categories